Molecular Biology

During DNA replication, the DNA double helix separates into two single strands, which act as templates for the synthesis of new strands. However, these single strands have a tendency to re-anneal, or coil back together. To prevent recoiling and ensure proper replication, specific proteins are involved in stabilizing the single strands. Let's examine the given options to determine the correct answer:

1. Single Strand Binding Protein (SSB): These proteins bind to the single strands of DNA during replication to prevent them from recoiling. They stabilize the unwound DNA and ensure that the replication process continues smoothly.
2. Reverse Transcriptase: This enzyme synthesizes DNA from an RNA template, which is important in the process of retroviral replication but does not play a role in preventing DNA strands from recoiling.
3. Endonuclease: These enzymes cut DNA strands at specific sites but are not involved in stabilizing single DNA strands during replication.
4. Polymerase: DNA polymerases are responsible for synthesizing new DNA strands complementary to the template strands, not for preventing recoiling of single strands.

From this analysis, it is clear that the correct answer is the Single Strand Binding Protein. They play a critical role in stabilizing the single strands and ensuring efficient replication.

In conclusion, the separated strands during the replication of DNA are prevented from recoiling by Single Strand Binding Proteins (SSB). These proteins hold the individual strands apart to allow the replication machinery to synthesize the new DNA properly.

Step 1: Antibiotics are matched with their microbial sources based on their discovery and production:
- (a) Chloromycetin (Chloramphenicol): Produced by Streptomyces venezuelae (3).
- (b) Erythromycin: Produced by Streptomyces erythreus (4).
- (c) Streptomycin: Produced by Streptomyces griseus (1).
- (d) Terramycin (Oxytetracycline): Produced by Streptomyces aurifaciens (2).

Step 2: Thus, the matches are: (a)-(3), (b)-(4), (c)-(1), (d)-(2).

i. Diagram: Diagram of DNA replication fork.
 
ii. Amino Acid Count: 
Start codon: AUG (position 7–9). Stop codon: UAG (position 28–30). 
Coding region: AUGGAGAUGACGACAAAAUUUUACUAG (21 nucleotides). 
Number of codons = . 
Subtract stop codon (not translated): 6 amino acids. 
Answer: i. Diagram labels Leading Strand, Lagging Strand, Replication Fork; ii. 6 amino acids.

Phases of PCR: Polymerase Chain Reaction (PCR) is a widely utilized technique in molecular biology for DNA amplification.
1. Denaturation: DNA strands are separated by heating them to 94-98°C to disrupt the hydrogen bonds.
2. Annealing: At 50-65°C, primers attach to specific target DNA sequences.
3. Extension: At 72°C, Taq polymerase extends the primers to synthesize new DNA strands.
4. Amplification: This process is repeated several times to exponentially multiply the amount of DNA.