Inheritance Of Two Genes
11 previous year questions.
High-Yield Trend
Chapter Questions 11 MCQs
(b) Explain the events which occur within a female Anopheles mosquito after it has sucked blood from a malaria patient.
What does the graph with respect to woman βXβ and woman βYβ indicate? Give a suitable reason.
mRNA Sequence: 5ββ UCAUUAACCCAGAUCUUCUUAAAAGGA β3β
How many amino acids will be formed from the given codons, if substitution of βUβ by βCβ takes place at the 5th codon? Explain your answer.
Assertion (A): Communities that comprise of more species tend to be more stable.
Reason (R): A higher number of species results in less year-to-year variation in total biomass.
Assertion (A): In birds, the sex of the offspring is determined by males.
Reason (R): Males are homogametic while females are heterogametic.
Assertion (A): In molecular diagnosis, single-stranded DNA or RNA tagged with a radioactive molecule is called a probe.
Reason (R): A probe always searches and hybridises with its complementary DNA in a clone of cells.
Assertion (1): AIDS is a syndrome caused by HIV.
Reason (R): HIV is a virus that damages the immune system with DNA as its genetic material.
About Inheritance Of Two Genes - CBSE-CLASS-XII
Inheritance Of Two Genes is a vital chapter for CBSE-CLASS-XII aspirants. Mastering the concepts covered in this chapter is essential for securing a top rank.
By rigorously practicing the previous year questions associated with this chapter, you can identify high-yield topics, understand the examiner's perspective, and boost your confidence during the actual exam.
Frequently Asked Questions
Why focus on Inheritance Of Two Genes PYQs?
Analyzing PYQs for this specific chapter reveals the most frequently tested concepts and the typical complexity of questions, allowing you to tailor your study plan efficiently.
How to best use this analysis?
Review the topic breakdown to see which sub-topics within Inheritance Of Two Genes carry the most weight. Then, tackle the questions iteratively to solidify your understanding.
